Hi Heng, could you elaborate? I've been surprised by this as well. Is there
a way to merge such that the read group we've supplied in the "rg.txt" file
(to go in the header) ends up in reads' RG:Z: tags, rather than the
filename?
~Joe
On Wed, Sep 28, 2011 at 8:48 AM, Heng Li <lh3@...> wrote:
> That all depends on how you merge files.
>
> Heng
>
> On Sep 28, 2011, at 11:38 AM, Michael Lindberg wrote:
>
> > I figured out the problem, apparently in a merged file, the file name
> goes in place of the RG:Z: rather than the true read group, is this
> intended?
> >
> > Begin forwarded message:
> >
> >> From: Michael Lindberg <mikerlindberg@...>
> >> Date: September 28, 2011 11:13:38 AM EDT
> >> To: samtools-help@...
> >> Subject: samtools view -r
> >>
> >> I believe that the samtools view -r option in the most recent release no
> longer works as expected.
> >>
> >>
> >> shared/bin/samtools-0.1.7/samtools view test.bam -r ERR000027 | head
> >> ERR000027.95 177 1 234402626 0 45M 4
> 148280096 0 TTTTTTTTTTTTTTTTTTATTGATCATTCTTGGGTGTTTCTCGCA
> ;<=>>????@@@@@AAA?@AA?@?@@A??@@>><?<??==<5;=9 XT:A:R NM:i:0 SM:i:0
> AM:i:0 X0:i:92 XM:i:0 XO:i:0 XG:i:0 MD:Z:45
> OQ:Z:II;5IIII8IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
> >> ERR000027.95 113 4 148280096 37 45M 1
> 234402626 0 CACGAGAGACCATATGTTGTATATTTCTATTTATGTGAAATGTCC
> 782:=;><<9==<>?<??<=?>?@@>>=???=>>;>=<<=>:<:: XT:A:U NM:i:0 SM:i:37
> AM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:45
> OQ:Z:AI5IIIIIIEIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
> >>
> >>
> >> /shared/bin/samtools1.18 view NA19239.discordants.readSorted.bam -r
> ERR000027
> >> #produces nothing
> >>
> >> /shared/bin/samtools1.16 view NA19239.discordants.readSorted.bam -r
> ERR000027
> >> #produces nothing
> >>
> >>
> >> Thanks,
> >> Mike
> >
> >
> ------------------------------------------------------------------------------
> > All the data continuously generated in your IT infrastructure contains a
> > definitive record of customers, application performance, security
> > threats, fraudulent activity and more. Splunk takes this data and makes
> > sense of it. Business sense. IT sense. Common sense.
> >
> http://p.sf.net/sfu/splunk-d2dcopy1_______________________________________________
> > Samtools-help mailing list
> > Samtools-help@...
> > https://lists.sourceforge.net/lists/listinfo/samtools-help
>
>
>
> --
> The Wellcome Trust Sanger Institute is operated by Genome Research
> Limited, a charity registered in England with number 1021457 and a
> company registered in England with number 2742969, whose registered
> office is 215 Euston Road, London, NW1 2BE.
>
>
> ------------------------------------------------------------------------------
> All the data continuously generated in your IT infrastructure contains a
> definitive record of customers, application performance, security
> threats, fraudulent activity and more. Splunk takes this data and makes
> sense of it. Business sense. IT sense. Common sense.
> http://p.sf.net/sfu/splunk-d2dcopy1
> _______________________________________________
> Samtools-help mailing list
> Samtools-help@...
> https://lists.sourceforge.net/lists/listinfo/samtools-help
>
--
Joseph Fass
Bioinformatics Programmer
UC Davis Bioinformatics Core
joseph.fass -at- gmail.com (professional)
970.227.5928 (c) || 530.752.2698 (w)
|