Update: I loaded the default score matrix - align_lib_nuc_matrix and still I
have the same problem. It is able to find matches during alignment, I think,
but fails to join the contigs. Here is the extract of the output I get:
---------------------------------
Automatic sequence assembler
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
Processing 1 in batch
File name P001__S101_A.exp
Reading length 571
New reading does not overlap: start a new contig
This gel reading has been given the number 1
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
Processing 2 in batch
File name P001__S101_B.exp
Reading length 469
Total matches found 0
New reading does not overlap: start a new contig
This gel reading has been given the number 2
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
Processing 3 in batch
File name P001__S101_C.exp
Reading length 522
Total matches found 1
Contig 2 position 366 matches strand 1 at position 23
Trying to align with contig 2
Percent mismatch 3.2, pads in contig 0, pads in gel 0
Percentage mismatch 3.2
344 354 364 374 384 394
Consensus
ATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAA
::::::::::::::::::::
::::::::::::::::::::::::::::::::::::::
Reading
-TCAATACATGGATGATTTGTGTGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAA
1 11 21 31 41 51
404 414 424 434 444 454
Consensus
AAATAGAGGAGCTGAGACAACATCTGTTGAGGTGGGGATTTACCACACCAGACCAAAAAA
::::::::::::::::::::::::::: :::::::::::::::::::::::::
::::::
Reading
AAATAGAGGAGCTGAGACAACATCTGT-GAGGTGGGGATTTACCACACCAGAC-AAAAAA
61 71 81 91 101 111
464
Consensus CATCAG
::::::
Reading CATCAG
121
Fri 20 Feb 11:39:11 2009 Failed file P001__S101_C.exp written to error file
Failed file P001__S101_C.exp written to error file
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
Processing 4 in batch
File name P001__S101_D.exp
....
....
Batch finished
7 sequences processed
2 sequences entered into database
0 joins made
0 joins failed
--------------------------------------------------------------
Surez wrote:
>
> I am trying to call the auto_assemble() function in gap.dll from a java
> program (Using JNI) to do a Shotgun Assembly. The assembler throws the
> following error:
>
> Automatic sequence assembler
> Database is logically consistent
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
> Processing 1 in batch
> File name P001__S101_A.exp
> Reading length 571
> Fri 13 Feb 12:05:26 2009 second sequence too short
> Fri 13 Feb 12:05:26 2009 Failed file P001__S101_A.exp written to error
> file
> Failed file P001__S101_A.exp written to error file
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
>
> This is how I call the auto_assemble() function:
> GapIO *io;
> inlist = "P001__S101_A.exp P001__S101_B.exp P001__S101_C.exp
> P001__S101_D.exp P001__S101_F.exp P001__S101_G.exp P001__S101_H.exp";
> int option = 1;
> int entry = 1;
> int disp_mode = 1;
> int min_ini_match = 20;
> int min_ovr = 0;
> int max_pad = 25;
> float max_pert_mis = 5.0;
> int align = 1;
> int joins = 1;
> int fail_mode = 1;
> int win_size = 0;
> int max_dash = 0;
> int ignore_prev = 1;
> float consensus_cutoff = 0;
> int status;
> int access = 0;
> io = open_db("vsdb", "0", &status, 0, access);
>
> int handle = get_free_handle(io);
>
> ret = auto_assemble(handle, inlist, option, entry, disp_mode,
> min_ini_match, min_ovr, max_pad, max_pert_mis, align, joins, fail_mode,
> win_size, max_dash, ignore_prev, consensus_cutoff);
>
> ----
> Can someone help me in solving this error.
>
> Thanks in advance,
> Surez
>
>
--
View this message in context: http://www.nabble.com/GAP4-Assembly-Error-%3A-second-sequence-too-short-tp22004232p22126053.html
Sent from the staden-package mailing list archive at Nabble.com.
|