Mapping and Assembly with Qualities

This should help you:
paf_utils.pl mapview2map

Usage: paf_utils.pl mapview2map <in.list> <in.mapview> > <out.map>

Notes: This `mapview2map' command works on a stream. It begins to write
       the output before it reads to the end of the input mapview
       file. Unfortunately, this command has to write the reference
       names in the header of <out.map> and the user must provide
       correct information to make it work properly.

       The input MUST satisfy the following conditions:

       1) <in.list> is a file that consists of the names of all
          reference sequences, one name per line.

       2) <in.mapview> must be sorted according to the read position.

       3) The names in <in.list> MUST appear in the identical order of
          sequence names in <in.mapview>.

Cheers,

Ryan


-----Original Message-----
From: treenomix@... [mailto:treenomix@...]
Sent: Wed 12/3/2008 3:44 PM
To: maq-help@...
Subject: [maq-help] convert mapview ouptu text file back to binary all.mapfile
 
Hi,
mapview.pl or "map mapview" generated a usefule text based file from  
binary "in.map" file.
After I deleted some bad alignemnts lines from the text file, I want to  
build a smaller new "out.map" binary file.

How do I do that?
I guess a reverse-engineered version code of "mapview.pl" will work if  
someone has one?

thanks,

nomix

Another case of MAQ SNP calling that I would like to discuss here:

cns.final.snp
PKD1 37187 T C 255 255 1.12 63 62
PKD1 37189 T C 255 255 1.56 63 62

These are so close to each other, and look very likely to be False
Positives. I was of the idea that MAQ throws such away, but not so..
 

Sumit Middha | Informatics Specialist | HSR | 507-284-4706 |
middha.sumit@... | Stabile 11-02-16 
Mayo Clinic | 200 First Street SW | Rochester, MN 55905 |
 http://www.mayoclinic.org

Although hets close to each other tend to be wrong, a lot of true SNPs  
are very close to each other. Excluding them would increase false  
negatives.

Heng


On 9 Dec 2008, at 22:11, Middha, Sumit wrote:

> Another case of MAQ SNP calling that I would like to discuss here:
>
> cns.final.snp
> PKD1 37187 T C 255 255 1.12 63 62
> PKD1 37189 T C 255 255 1.56 63 62
>
> These are so close to each other, and look very likely to be False  
> Positives. I was of the idea that MAQ throws such away, but not so..
>
> Sumit Middha | Informatics Specialist | HSR | 507-284-4706 | middha.sumit@... 
>  | Stabile 11-02-16
> Mayo Clinic | 200 First Street SW | Rochester, MN 55905 | http://www.mayoclinic.org
>
>
> ------------------------------------------------------------------------------
> SF.Net email is Sponsored by MIX09, March 18-20, 2009 in Las Vegas,  
> Nevada.
> The future of the web can't happen without you.  Join us at MIX09 to  
> help
> pave the way to the Next Web now. Learn more and register at
> http://ad.doubleclick.net/clk;208669438;13503038;i?http://2009.visitmix.com/_______________________________________________
> maq-help mailing list
> maq-help@...
> https://lists.sourceforge.net/lists/listinfo/maq-help

Dear list,

I have just analysed a Solexa PhiX lane for SNPs using MAQ SNPfilter option and I have found that I get some 50 SNP calls after having filtered out poor calls using -d3 and -Q40 and then filtering the resulting list by the phred like consensus quality (by value of 30). All the consensus calls are either M or K and the second best call is actually the good base. The experiment seemed to run properly so I shouldn´t expect any SNPs, right? Should I tune the options differently? I guess all the SNPs are false positives, are they? Here are two of the SNPs called in the output:

chr_Phi     57  C  M  89  255  1  63  62  C  255  A
chr_Phi   319  G  K  105  255  1  63  54  G  255  T

Thanks for your input and happy Xmas,



Dave
_________________________________________________________________
Drag n’ drop—Get easy photo sharing with Windows Live™ Photos.

http://www.microsoft.com/windows/windowslive/photos.aspx

Hello David,

Maqview does not show indel alignments properly. If you are  
interested, you may try another tool, samtools (http://samtools.sourceforge.net 
), which is mainly developed by Bob from Broad and me. SAM format is  
expected to be the standard alignment format for the 1000genomes  
project. It supports long reads and gapped alignment. A ncurses-based  
alignment viewer has already been implemented and fully supports  
gapped alignment.

Currently, samtools is only available from SVN, but it is working. A  
maq->sam converter is provided with the package.

Heng

On 11 Dec 2008, at 11:53, David Van Heel wrote:

> Dear list,
>
> We've been looking at indels in human gDNA data from gapped  
> alignments (45bp
> x 2 paired end GAII data).
>
> We generated the gapped alignments both in maq 0.6.8, and also from
> novoalign then converted with novo2maq in maq 0.6.8-1.
>
> Some issues have cropped up:
> - gapped alignments don't seem to show properly in maqview (0.2.0 and
> 0.2.4). Read appears to have a lot of mismatches.
> - read with gapped alignment doesn't get reported by maq pileup.
>
> Anybody else noticed this? Have we done something stupid? Any of these
> issues dealt with in later versions / workarounds?
>
> Regards
>
> David van Heel
>
>
>
>
> ------------------------------------------------------------------------------
> SF.Net email is Sponsored by MIX09, March 18-20, 2009 in Las Vegas,  
> Nevada.
> The future of the web can't happen without you.  Join us at MIX09 to  
> help
> pave the way to the Next Web now. Learn more and register at
> http://ad.doubleclick.net/clk;208669438;13503038;i?http://2009.visitmix.com/
> _______________________________________________
> maq-help mailing list
> maq-help@...
> https://lists.sourceforge.net/lists/listinfo/maq-help

Sorry. Maq is endianness sensitive. If you create .bfq/.map on an  
Intel machine, it will not work on a ppc machine. I am working on a  
new format which should avoid this complication.

Heng


On 8 Dec 2008, at 15:52, Christian Weihrauch wrote:

> Hi,
>
> I am trying to get maq-7.0.1 working on my system with no luck. I have
> SLES10 SP1 on ppc64 with gcc-4.1.2 compiler.
>
> maq configures and makes without seeing any problems. Conversion of
> fasta and fastq files seems to work.
>
> However when I run maq it can't find any matches:
>
> shell# maq-0.7.1/maq map test.map refgenome.bfa SRR001412.5.bfq
> -- maq-0.7.1
> [ma_load_reads] loading reads...
> [ma_load_reads] set length of the first read as 24.
> [ma_load_reads] 464742*2 reads loaded.
> [ma_longread2read] encoding reads... 929484 sequences processed.
> [ma_match] set the minimum insert size as 25.
> [match_core] Total length of the reference: 3080419480
> [match_core] round 1/3...
> [match_core] making index...
> [match_search]   0% processed in 2.991 sec: 0 / 0 = 0.000
> [match_search]   1% processed in 7.461 sec: 0 / 0 = 0.000
> [match_search]   2% processed in 11.933 sec: 0 / 0 = 0.000
> [match_search]   3% processed in 16.392 sec: 0 / 0 = 0.000
> [match_search]   4% processed in 20.865 sec: 0 / 0 = 0.000
> ####
> snip
> ####
> [match_search] 100% processed in 742.843 sec: 0 / 0 = 0.000
> [match_core] sorting the hits and dumping the results...
> [ma_load_reads] loading reads...
> [ma_load_reads] 464742*2 reads loaded.
> [mapping_count_single] 0, 0, 0, 0
> [maq_indel_pe] the indel detector only works with short-insert mate- 
> pair
> reads.
> [match_data2mapping] 0 out of 929484 raw reads are mapped with 0 in  
> pairs.
> -- (total, isPE, mapped, paired) = (464742, 0, 0, 0)
>
>
> On a 64bit Intel machine it runs fine using the same initial data (bfa
> and bfq where regenerated for each architecture):
>
> shell# map test.map refgenome.bfa SRR001412/SRR001412.5.bfq
> -- maq-0.7.1
> [ma_load_reads] loading reads...
> [ma_load_reads] set length of the first read as 24.
> [ma_load_reads] 464742*2 reads loaded.
> [ma_longread2read] encoding reads... 929484 sequences processed.
> [ma_match] set the minimum insert size as 25.
> [match_core] Total length of the reference: 3080419480
> [match_core] round 1/3...
> [match_core] making index...
> [match_search]   0% processed in 1.224 sec: 0 / 0 = 0.000
> [match_search]   1% processed in 22.257 sec: 31053133 / 17756226 =  
> 1.749
> [match_search]   2% processed in 41.263 sec: 24781495 / 15233648 =  
> 1.627
> [match_search]   3% processed in 56.668 sec: 13839279 / 11138540 =  
> 1.242
>
> Is this architecture supported? Are there any known issues with this
> kind of setup?
> Any idea where to start debugging?
>
> Thanks!
>
> Christian Weihrauch
> University of Reading, UK
>
> ------------------------------------------------------------------------------
> SF.Net email is Sponsored by MIX09, March 18-20, 2009 in Las Vegas,  
> Nevada.
> The future of the web can't happen without you.  Join us at MIX09 to  
> help
> pave the way to the Next Web now. Learn more and register at
> http://ad.doubleclick.net/clk;208669438;13503038;i?http://2009.visitmix.com/
> _______________________________________________
> maq-help mailing list
> maq-help@...
> https://lists.sourceforge.net/lists/listinfo/maq-help

Dear Heng,

Thanks for your reply. I had generated bfa and bfq on ppc and then saw 
the below described problem.

Do you know anyone using maq on ppc/Linux? Any idea how to debug where 
the problem may be?

Chris

Heng Li wrote:
> Sorry. Maq is endianness sensitive. If you create .bfq/.map on an Intel 
> machine, it will not work on a ppc machine. I am working on a new format 
> which should avoid this complication.
> 
> Heng
> 
> 
> On 8 Dec 2008, at 15:52, Christian Weihrauch wrote:
> 
>> Hi,
>>
>> I am trying to get maq-7.0.1 working on my system with no luck. I have
>> SLES10 SP1 on ppc64 with gcc-4.1.2 compiler.
>>
>> maq configures and makes without seeing any problems. Conversion of
>> fasta and fastq files seems to work.
>>
>> However when I run maq it can't find any matches:
>>
>> shell# maq-0.7.1/maq map test.map refgenome.bfa SRR001412.5.bfq
>> -- maq-0.7.1
>> [ma_load_reads] loading reads...
>> [ma_load_reads] set length of the first read as 24.
>> [ma_load_reads] 464742*2 reads loaded.
>> [ma_longread2read] encoding reads... 929484 sequences processed.
>> [ma_match] set the minimum insert size as 25.
>> [match_core] Total length of the reference: 3080419480
>> [match_core] round 1/3...
>> [match_core] making index...
>> [match_search]   0% processed in 2.991 sec: 0 / 0 = 0.000
>> [match_search]   1% processed in 7.461 sec: 0 / 0 = 0.000
>> [match_search]   2% processed in 11.933 sec: 0 / 0 = 0.000
>> [match_search]   3% processed in 16.392 sec: 0 / 0 = 0.000
>> [match_search]   4% processed in 20.865 sec: 0 / 0 = 0.000
>> ####
>> snip
>> ####
>> [match_search] 100% processed in 742.843 sec: 0 / 0 = 0.000
>> [match_core] sorting the hits and dumping the results...
>> [ma_load_reads] loading reads...
>> [ma_load_reads] 464742*2 reads loaded.
>> [mapping_count_single] 0, 0, 0, 0
>> [maq_indel_pe] the indel detector only works with short-insert mate-pair
>> reads.
>> [match_data2mapping] 0 out of 929484 raw reads are mapped with 0 in 
>> pairs.
>> -- (total, isPE, mapped, paired) = (464742, 0, 0, 0)
>>
>>
>> On a 64bit Intel machine it runs fine using the same initial data (bfa
>> and bfq where regenerated for each architecture):
>>
>> shell# map test.map refgenome.bfa SRR001412/SRR001412.5.bfq
>> -- maq-0.7.1
>> [ma_load_reads] loading reads...
>> [ma_load_reads] set length of the first read as 24.
>> [ma_load_reads] 464742*2 reads loaded.
>> [ma_longread2read] encoding reads... 929484 sequences processed.
>> [ma_match] set the minimum insert size as 25.
>> [match_core] Total length of the reference: 3080419480
>> [match_core] round 1/3...
>> [match_core] making index...
>> [match_search]   0% processed in 1.224 sec: 0 / 0 = 0.000
>> [match_search]   1% processed in 22.257 sec: 31053133 / 17756226 = 1.749
>> [match_search]   2% processed in 41.263 sec: 24781495 / 15233648 = 1.627
>> [match_search]   3% processed in 56.668 sec: 13839279 / 11138540 = 1.242
>>
>> Is this architecture supported? Are there any known issues with this
>> kind of setup?
>> Any idea where to start debugging?
>>
>> Thanks!
>>
>> Christian Weihrauch
>> University of Reading, UK
>>
>> ------------------------------------------------------------------------------ 
>>
>> SF.Net email is Sponsored by MIX09, March 18-20, 2009 in Las Vegas, 
>> Nevada.
>> The future of the web can't happen without you.  Join us at MIX09 to help
>> pave the way to the Next Web now. Learn more and register at
>> http://ad.doubleclick.net/clk;208669438;13503038;i?http://2009.visitmix.com/ 
>>
>> _______________________________________________
>> maq-help mailing list
>> maq-help@...
>> https://lists.sourceforge.net/lists/listinfo/maq-help
> 

-- 
Christian Weihrauch, M.Sc., Dipl.-Ing. (FH)

ACET Centre
School of System Engineering
The University of Reading
Philip Lyle Building
Whiteknights, PO Box 68
Reading, RG6 6BX, UK
---------------------------------------------------------------------
E-mail: c.weihrauch@...
Tel:   +44 (0)118 378 4415
Fax:   +44 (0)118 378 5224
WWW:   http://acet.rdg.ac.uk/~cw/
---------------------------------------------------------------------
Web-site: http://acet.rdg.ac.uk/
---------------------------------------------------------------------

Jiexin,

Your input file is not fastq; it's fasta.  If it were (solexa or sanger)
fastq, it would look like this:
@CMLIVERKIDNEY_7:1:1:112:735
GTGGTGGGGTTGGTATTTGGTTTCTCGTTTTA
+CMLIVERKIDNEY_7:1:1:112:735 (or these '+' lines could be empty)
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@CMLIVERKIDNEY_7:1:1:114:564
GGATACTCAGGCTGGCCCAATTTCTGGGCGTG +CMLIVERKIDNEY_7:1:1:114:564
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@CMLIVERKIDNEY_7:1:1:109:558
GTAGAATTAGAATTGTGAAGATGATAAGTGTA +CMLIVERKIDNEY_7:1:1:109:558
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII

see http://maq.sourceforge.net/fastq.shtml for the conversion of the quality
characters to phred scores ... maq sol2sanger just changes the scale / range
of these ...
maybe your Illumina pipeline was run to produce fasta, not fastq? (not sure
if that can be done) ... or maybe someone converted to fasta already?

Hope that helps,
~Joe






On Tue, Dec 2, 2008 at 2:18 PM, Zhang,Jiexin <JiexinZhang@...:

>  Hi,
>
> I am new to MAQ, and was trying to convert one of my reads files from
> Solexa into fastq file. I did the following:
> ./maq sol2sanger s_1_sequence.txt s_1_sequence.fastq
>
> There is no error message, but my output s_1_sequence.fastq file is empty.
> My input file looks like the following:
> >CMLIVERKIDNEY_7:1:1:112:735
> GTGGTGGGGTTGGTATTTGGTTTCTCGTTTTA
> >CMLIVERKIDNEY_7:1:1:114:564
> GGATACTCAGGCTGGCCCAATTTCTGGGCGTG
> >CMLIVERKIDNEY_7:1:1:109:558
> GTAGAATTAGAATTGTGAAGATGATAAGTGTA
> …
>
> What would have gone wrong? Thanks a lot,
>
> Jiexin
> ***********************************************************
>   To do great work, you have to have a pure mind.
>   Everything else is human weakness.
>
>                                                              -- Mikhail
> Gromov
> ***********************************************************
>
>
>
>
>
> ------------------------------------------------------------------------------
> SF.Net email is Sponsored by MIX09, March 18-20, 2009 in Las Vegas, Nevada.
> The future of the web can't happen without you.  Join us at MIX09 to help
> pave the way to the Next Web now. Learn more and register at
>
> http://ad.doubleclick.net/clk;208669438;13503038;i?http://2009.visitmix.com/
> _______________________________________________
> maq-help mailing list
> maq-help@...
> https://lists.sourceforge.net/lists/listinfo/maq-help
>
>


-- 
Joseph Fass
Bioinformatics Programmer
UC Davis Bioinformatics Core
joseph.fass -at- gmail.com (professional)
970.227.5928 (c)  ||  530.752.2698 (w)

Hello,
   Your input file is not in solexa format, it is in fasta format, ask
whoever runs your pipeline for the original s_1_sequence.txt file.

Joel

On Tue, Dec 02, 2008 at 04:18:58PM -0600, Zhang,Jiexin wrote:
> Hi,
> 
> I am new to MAQ, and was trying to convert one of my reads files from Solexa into fastq file. I did the following:
> ./maq sol2sanger s_1_sequence.txt s_1_sequence.fastq
> 
> There is no error message, but my output s_1_sequence.fastq file is empty. My input file looks like the following:
> >CMLIVERKIDNEY_7:1:1:112:735
> GTGGTGGGGTTGGTATTTGGTTTCTCGTTTTA
> >CMLIVERKIDNEY_7:1:1:114:564
> GGATACTCAGGCTGGCCCAATTTCTGGGCGTG
> >CMLIVERKIDNEY_7:1:1:109:558
> GTAGAATTAGAATTGTGAAGATGATAAGTGTA
> ...
> 
> What would have gone wrong? Thanks a lot,
> 
> Jiexin
> ***********************************************************
>   To do great work, you have to have a pure mind.
>   Everything else is human weakness.
> 
>                                                              -- Mikhail Gromov
> ***********************************************************
> 
> 
> 

> ------------------------------------------------------------------------------
> SF.Net email is Sponsored by MIX09, March 18-20, 2009 in Las Vegas, Nevada.
> The future of the web can't happen without you.  Join us at MIX09 to help
> pave the way to the Next Web now. Learn more and register at
> http://ad.doubleclick.net/clk;208669438;13503038;i?http://2009.visitmix.com/
> _______________________________________________
> maq-help mailing list
> maq-help@...
> https://lists.sourceforge.net/lists/listinfo/maq-help

Joseph, Joel and Liang,

Thanks for your help. I am still a little puzzled though. The file I've shown is the s_8_sequence.txt file under GERALD directory. If not this one, which one contains fastq file? I have the following txt files for 8th lane under GERALD. Thanks a lot for your suggestions.
s_8_coverage
s_8_cov.txt
s_8_filt.txt
s_8_finished.txt
s_8_qcalreport.txt
s_8_qreport.txt
s_8_qtable.txt
s_8_seqpre.txt
s_8_sequence.txt
s_8_Signal_Means.txt

Jiexin
***********************************************************
  To do great work, you have to have a pure mind.
  Everything else is human weakness.

                                                             -- Mikhail Gromov
***********************************************************

From: Joseph Fass [mailto:joseph.fass@...]
Sent: Monday, December 08, 2008 11:57 AM
To: Zhang,Jiexin
Cc: maq-help@...
Subject: Re: [maq-help] difficulty of converting reads file to fastq file

Jiexin,

Your input file is not fastq; it's fasta.  If it were (solexa or sanger) fastq, it would look like this:
@CMLIVERKIDNEY_7:1:1:112:735
GTGGTGGGGTTGGTATTTGGTTTCTCGTTTTA
+CMLIVERKIDNEY_7:1:1:112:735 (or these '+' lines could be empty)
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@CMLIVERKIDNEY_7:1:1:114:564
GGATACTCAGGCTGGCCCAATTTCTGGGCGTG
+CMLIVERKIDNEY_7:1:1:114:564
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@CMLIVERKIDNEY_7:1:1:109:558
GTAGAATTAGAATTGTGAAGATGATAAGTGTA
+CMLIVERKIDNEY_7:1:1:109:558
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII

see http://maq.sourceforge.net/fastq.shtml for the conversion of the quality characters to phred scores ... maq sol2sanger just changes the scale / range of these ...
maybe your Illumina pipeline was run to produce fasta, not fastq? (not sure if that can be done) ... or maybe someone converted to fasta already?

Hope that helps,
~Joe





On Tue, Dec 2, 2008 at 2:18 PM, Zhang,Jiexin <JiexinZhang@...>> wrote:
Hi,

I am new to MAQ, and was trying to convert one of my reads files from Solexa into fastq file. I did the following:
./maq sol2sanger s_1_sequence.txt s_1_sequence.fastq

There is no error message, but my output s_1_sequence.fastq file is empty. My input file looks like the following:
>CMLIVERKIDNEY_7:1:1:112:735
GTGGTGGGGTTGGTATTTGGTTTCTCGTTTTA
>CMLIVERKIDNEY_7:1:1:114:564
GGATACTCAGGCTGGCCCAATTTCTGGGCGTG
>CMLIVERKIDNEY_7:1:1:109:558
GTAGAATTAGAATTGTGAAGATGATAAGTGTA
...

What would have gone wrong? Thanks a lot,

Jiexin
***********************************************************
  To do great work, you have to have a pure mind.
  Everything else is human weakness.

                                                             -- Mikhail Gromov
***********************************************************




------------------------------------------------------------------------------
SF.Net email is Sponsored by MIX09, March 18-20, 2009 in Las Vegas, Nevada.
The future of the web can't happen without you.  Join us at MIX09 to help
pave the way to the Next Web now. Learn more and register at
http://ad.doubleclick.net/clk;208669438;13503038;i?http://2009.visitmix.com/
_______________________________________________
maq-help mailing list
maq-help@...>
https://lists.sourceforge.net/lists/listinfo/maq-help



--
Joseph Fass
Bioinformatics Programmer
UC Davis Bioinformatics Core
joseph.fass -at- gmail.com<http://gmail.com> (professional)
970.227.5928 (c)  ||  530.752.2698 (w)

Hi, Jiexin

 

I suggest you re-run the Gerald portion of the pipeline, but replace
add/replace the option to generate fastq files in the Gerald config file.
This way the sequence.txt files will be in fastq format. 

 

e.g.

ANALYSIS sequence_pair

SEQUENCE_FORMAT -fastq

 

Graham

 

 

From: Zhang,Jiexin [mailto:JiexinZhang@...] 
Sent: 08 December 2008 19:54
To: maq-help@...
Subject: Re: [maq-help] difficulty of converting reads file to fastq file

 

Joseph, Joel and Liang,

 

Thanks for your help. I am still a little puzzled though. The file I've
shown is the s_8_sequence.txt file under GERALD directory. If not this one,
which one contains fastq file? I have the following txt files for 8th lane
under GERALD. Thanks a lot for your suggestions.

s_8_coverage

s_8_cov.txt

s_8_filt.txt

s_8_finished.txt

s_8_qcalreport.txt

s_8_qreport.txt

s_8_qtable.txt

s_8_seqpre.txt

s_8_sequence.txt

s_8_Signal_Means.txt

 

Jiexin

***********************************************************

  To do great work, you have to have a pure mind. 

  Everything else is human weakness. 

 

                                                             -- Mikhail
Gromov

***********************************************************

 

From: Joseph Fass [mailto:joseph.fass@...] 
Sent: Monday, December 08, 2008 11:57 AM
To: Zhang,Jiexin
Cc: maq-help@...
Subject: Re: [maq-help] difficulty of converting reads file to fastq file

 

Jiexin,

Your input file is not fastq; it's fasta.  If it were (solexa or sanger)
fastq, it would look like this:

@CMLIVERKIDNEY_7:1:1:112:735

GTGGTGGGGTTGGTATTTGGTTTCTCGTTTTA

+CMLIVERKIDNEY_7:1:1:112:735 (or these '+' lines could be empty)
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII

@CMLIVERKIDNEY_7:1:1:114:564

GGATACTCAGGCTGGCCCAATTTCTGGGCGTG 

+CMLIVERKIDNEY_7:1:1:114:564
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII

@CMLIVERKIDNEY_7:1:1:109:558

GTAGAATTAGAATTGTGAAGATGATAAGTGTA 

+CMLIVERKIDNEY_7:1:1:109:558

IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII

see http://maq.sourceforge.net/fastq.shtml for the conversion of the quality
characters to phred scores ... maq sol2sanger just changes the scale / range
of these ...
maybe your Illumina pipeline was run to produce fasta, not fastq? (not sure
if that can be done) ... or maybe someone converted to fasta already?

Hope that helps,
~Joe






On Tue, Dec 2, 2008 at 2:18 PM, Zhang,Jiexin <JiexinZhang@...>
wrote:

Hi,

 

I am new to MAQ, and was trying to convert one of my reads files from Solexa
into fastq file. I did the following:

./maq sol2sanger s_1_sequence.txt s_1_sequence.fastq

 

There is no error message, but my output s_1_sequence.fastq file is empty.
My input file looks like the following:

>CMLIVERKIDNEY_7:1:1:112:735

GTGGTGGGGTTGGTATTTGGTTTCTCGTTTTA

>CMLIVERKIDNEY_7:1:1:114:564

GGATACTCAGGCTGGCCCAATTTCTGGGCGTG

>CMLIVERKIDNEY_7:1:1:109:558

GTAGAATTAGAATTGTGAAGATGATAAGTGTA

.

 

What would have gone wrong? Thanks a lot,

 

Jiexin

***********************************************************

  To do great work, you have to have a pure mind. 

  Everything else is human weakness. 

 

                                                             -- Mikhail
Gromov

***********************************************************

 

 

 


----------------------------------------------------------------------------
--
SF.Net email is Sponsored by MIX09, March 18-20, 2009 in Las Vegas, Nevada.
The future of the web can't happen without you.  Join us at MIX09 to help
pave the way to the Next Web now. Learn more and register at
http://ad.doubleclick.net/clk;208669438;13503038;i?http://2009.visitmix.com/
_______________________________________________
maq-help mailing list
maq-help@...
https://lists.sourceforge.net/lists/listinfo/maq-help




-- 
Joseph Fass
Bioinformatics Programmer
UC Davis Bioinformatics Core
joseph.fass -at- gmail.com (professional)
970.227.5928 (c)  ||  530.752.2698 (w)

Hello Takeshi,

You need to provide the consensus file .cns to maqview. Note that the  
reference sequence is stored in .cns, but not in .map.

Heng

On 2 Dec 2008, at 12:19, Takeshi YASUDA (Moritex) wrote:

> Hello,
>
>  I am using maq 0.6.8 and maqview 0.2.4.
>
>  Reference sequence on maqview gets to XXXXX when I opened .map file  
> with o option on maqview window.
>
>  Any idea ?
>
> OS: Opensuse 11.0 x86_64
>
> Thank you.
>
> ytk
> -------------------------------------------------------------------------
> This SF.Net email is sponsored by the Moblin Your Move Developer's  
> challenge
> Build the coolest Linux based applications with Moblin SDK & win  
> great prizes
> Grand prize is a trip for two to an Open Source event anywhere in  
> the world
> http://moblin-contest.org/redirect.php?banner_id=100&url=/_______________________________________________
> maq-help mailing list
> maq-help@...
> https://lists.sourceforge.net/lists/listinfo/maq-help

Hi there is a problem with maqindex.  It is currently producing a .summary file which lacks a lot of 
the required information.  Jue Ruan sent me the following file to replace in the source tree.  When 
you recompile maqview 0.2.4 will work.

You should find that 0.2.3 does not have this problem.

Regards
Aengus



Heng Li wrote:
> Hello Takeshi,
> 
> You need to provide the consensus file .cns to maqview. Note that the  
> reference sequence is stored in .cns, but not in .map.
> 
> Heng
> 
> On 2 Dec 2008, at 12:19, Takeshi YASUDA (Moritex) wrote:
> 
>> Hello,
>>
>>  I am using maq 0.6.8 and maqview 0.2.4.
>>
>>  Reference sequence on maqview gets to XXXXX when I opened .map file  
>> with o option on maqview window.
>>
>>  Any idea ?
>>
>> OS: Opensuse 11.0 x86_64
>>
>> Thank you.
>>
>> ytk
>> -------------------------------------------------------------------------
>> This SF.Net email is sponsored by the Moblin Your Move Developer's  
>> challenge
>> Build the coolest Linux based applications with Moblin SDK & win  
>> great prizes
>> Grand prize is a trip for two to an Open Source event anywhere in  
>> the world
>> http://moblin-contest.org/redirect.php?banner_id=100&url=/_______________________________________________
>> maq-help mailing list
>> maq-help@...
>> https://lists.sourceforge.net/lists/listinfo/maq-help
> 
> 
> -------------------------------------------------------------------------
> This SF.Net email is sponsored by the Moblin Your Move Developer's challenge
> Build the coolest Linux based applications with Moblin SDK & win great prizes
> Grand prize is a trip for two to an Open Source event anywhere in the world
> http://moblin-contest.org/redirect.php?banner_id=100&url=/
> _______________________________________________
> maq-help mailing list
> maq-help@...
> https://lists.sourceforge.net/lists/listinfo/maq-help
> 
> 

-- 
-----------------------------------------------------------------------
Aengus Stewart
Head of Bioinformatics and BioStatistics
Bioinformatics and BioStatistics               Tel: +44 (0)20 7269 3679
Cancer Research UK, Lincoln's Inn Fields, Holborn, London, WC2A 3PX, UK
-----------------------------------------------------------------------

This electronic message contains information which may be privileged and
confidential.  The information is intended to be for the use of the
individual(s) or entity named above. Be aware that any third party
disclosure, distribution, copying or use of this communication, without
prior permission, is strictly prohibited.

This communication is from Cancer Research UK. Our website is at http://www.cancerresearchuk.org. We are a charity registered under number 1089464 and a company limited by guarantee registered in England & Wales under number 4325234. Our registered address is 61 Lincoln's Inn Fields, London WC2A 3PX. Our central telephone number is 020 7242 0200.
 
This communication and any attachments contain information which is confidential and may also be privileged.   It is for the exclusive use of the intended recipient(s).  If you are not the intended recipient(s) please note that any form of disclosure, distribution, copying or use of this communication or the information in it or in any attachments is strictly prohibited and may be unlawful.  If you have received this communication in error, please notify the sender and delete the email and destroy any copies of it.
 
E-mail communications cannot be guaranteed to be secure or error free, as information could be intercepted, corrupted, amended, lost, destroyed, arrive late or incomplete, or contain viruses.  We do not accept liability for any such matters or their consequences.  Anyone who communicates with us by e-mail is taken to accept the risks in doing so.